This web page was produced as an assignment for Genetics 564, an undergraduate course at UW-Madison.
Recent Research Updates
Just months after Stoll's lab published its findings describing TOP3B and schizophrenia, another lab published their findings that relate to Stoll's description of the complex formed by TOP3β and TDRD3 (a protein connected to Fragile X Syndrome). Yang's lab studied the relationship between TDRD3, TOP3B, and R loops. I believe that by looking at the information presented in Basset's review (see The TOP3B Gene page), Stoll's publication, and Yang's publication; we can gain insight into possible mechanisms through which a TOP3B deletion leads to a schizophrenic phenotype.
R loops are structures containing three strands of nucleic acid: an RNA strand, DNA strand, and a displaced DNA strand that is identical to the RNA strand [2]. Thus far, all R loops discovered to naturally exist in the human body are formed by transcription. Research has substantiated the "tread-back" theory of R loop formation, during which the new RNA strand invades the DNA duplex when it should not. The image below provides an example of what it would look like.
R loops are structures containing three strands of nucleic acid: an RNA strand, DNA strand, and a displaced DNA strand that is identical to the RNA strand [2]. Thus far, all R loops discovered to naturally exist in the human body are formed by transcription. Research has substantiated the "tread-back" theory of R loop formation, during which the new RNA strand invades the DNA duplex when it should not. The image below provides an example of what it would look like.
The purple bubble here represents the normal transcription bubble. The RNA in the purple bubble is being produced. However, once the RNA is made and trails out of the transcription bubble as it grows, the RNA tail should not reenter the DNA duplex. The dashed red line represents an RNA tail that has reinvaded the DNA duplex, thus forming an R loop.
R loops are naturally formed within the cell through multiple processes; however, they also pose a threat to proper gene expression and genomic stability [2]. An example of how R loops can inhibit proper gene expression can be seen in the image below.
By Yang's lab, TOP3B has been found to play an important role in minimizing the formation of R loops. As a topoisomerase, TOP3β reduces negative supercoiling of the DNA strands as the transcription bubble moves across the DNA helix. By doing so, TOP3β also resolves the formation of R loops. Through this activity, TOP3β promotes transcription, protects against DNA damage, and reduces the frequency of chromosomal translocations [1]. This allows the cell to continue to function as normal and prevents mutations that could alter or delete vital DNA information for the cell and potentially cause genetic illnesses in offspring.
As a quick side note, a chromosomal translocation occurs when part of the chromosome is moved to a different chromosomal location where it is not supposed to be.
As a quick side note, a chromosomal translocation occurs when part of the chromosome is moved to a different chromosomal location where it is not supposed to be.
The translocation pictured above is an example of a balanced translocation, which are often not harmful as no genetic material is lost or gained. However, unbalanced translocations also occur. In such an instance, the result is one chromosome with extra genetic material and one chromosome missing genetic material [3]. An unbalanced chromosome could then be passed on to offspring during reproduction when the translocation occurs during meiosis. Unbalanced translocations can also result in chromosomes that are too small to survive and will be lost during meiosis. This could result in developmental delay, learning disability, or other health problems in the child [3].
The top arrow shows a balanced translocation. The bottom arrow shows an unbalanced translocation. This particular unbalanced translocation is also an example of when one of the resulting chromosomes is too small to survive mitosis and will be lost, which will result in a gamete (egg or sperm) missing a chromosome.
The lab of Ahn et. al. found that individuals diagnosed with early onset schizophrenia (defined as diagnosed before age 13) are likely to have a greater number of pathogenic copy number variants (CNV) associated with adult onset schizophrenia, autism, epilepsy, and/or intellectual disability than both their healthy siblings and those with adult onset schizophrenia [4]. A CNV is when a section of the genetic sequence is duplicated and/or deleted resulting in individuals with different numbers of copies of these sequence, such as one copy (appearing as ACGT) or five copies (appearing as ACGTACGTACGTACGTACGT). A CNV could cause an increase in the number of copies an individual has or a decrease in the number of copies an individual has. The results obtained by Ahn et. al. demonstrate that CNV act in an additive fashion to produce more extreme phenotypes as more CNV are present within an individual [4].
To me, Ahn's results also demonstrate, once again, the importance functional and wild type TOP3B, as its role in preserving genetic stability and preventing translocations (which can lead to mutations, including CNV) works to prevent an expanding numbers of CNV in individuals. Furthermore, I think all the results discussed on this page, as well as those of Basset referenced on The TOP3B Gene page, demonstrate the possibility that neurodevelopmental disorders are connected, even down to their mechanism of symptom onset. Both Stoll and Yang present a well defined connection between TOP3B and TDRD3--linking schizophrenia and Fragile X. I think to truly understand this group of diseases (and their associated genes), from the small scale mechanism to the large scale clinical presentation, they must be studied with the other associated diseases in mind. Perhaps this methodology will enable reaching a deep understanding of the genetic and cellular understanding of these diseases faster.
To me, Ahn's results also demonstrate, once again, the importance functional and wild type TOP3B, as its role in preserving genetic stability and preventing translocations (which can lead to mutations, including CNV) works to prevent an expanding numbers of CNV in individuals. Furthermore, I think all the results discussed on this page, as well as those of Basset referenced on The TOP3B Gene page, demonstrate the possibility that neurodevelopmental disorders are connected, even down to their mechanism of symptom onset. Both Stoll and Yang present a well defined connection between TOP3B and TDRD3--linking schizophrenia and Fragile X. I think to truly understand this group of diseases (and their associated genes), from the small scale mechanism to the large scale clinical presentation, they must be studied with the other associated diseases in mind. Perhaps this methodology will enable reaching a deep understanding of the genetic and cellular understanding of these diseases faster.
References
[1] Yang, Y., McBride, K.M., Hensley, S., Lu, Y., Chedin, F., Bedford, M.T. Arginine Methylation Facilitates the Recruitment of TOP3B to Chromatin to Prevent R Loop Accumulation. Mol Cell. 2014 Feb 6;53(3):484-97. doi: 10.1016/j.molcel.2014.01.011.
[2]. Aguilera, A. and Garcia-Muse, T. R Loops: From Transcription Byproducts to Threats to Genome Stability. Mol Cell. Volume 46, Issue 2, 27 April 2012, Pages 115–124. doi:10.1016/j.molcel.2012.04.009.
[3]. EuroGentest. Chromosome Translocations. Created Jan, 2007. Retrieved Jan 27, 2015. http://www.eurogentest.org/index.php?id=612
[4]. Ahn, K. et. al. High Rate of Disease-Related Copy Number Variations in Childhood Onset Schizophrenia. Mol Psychiatry. 2014 May;19(5):568-72. doi: 10.1038/mp.2013.59. Epub 2013 May 21. PMID: 23689535
[2]. Aguilera, A. and Garcia-Muse, T. R Loops: From Transcription Byproducts to Threats to Genome Stability. Mol Cell. Volume 46, Issue 2, 27 April 2012, Pages 115–124. doi:10.1016/j.molcel.2012.04.009.
[3]. EuroGentest. Chromosome Translocations. Created Jan, 2007. Retrieved Jan 27, 2015. http://www.eurogentest.org/index.php?id=612
[4]. Ahn, K. et. al. High Rate of Disease-Related Copy Number Variations in Childhood Onset Schizophrenia. Mol Psychiatry. 2014 May;19(5):568-72. doi: 10.1038/mp.2013.59. Epub 2013 May 21. PMID: 23689535